Edited by Tom Cohen

Telemorphosis: Theory in the Era of Climate Change, Vol. 1

    4. Unicity

    Unicity is a term produced by the 1963 poem “cidade/city/cité” by the Brazilian poet Augusto de Campos that I have derived as a concept describing world order during globalization. The “nature” of this concept is such, however, that we cannot think of “Unicity” as conceptual in a normative way. That is, “Unicity” does operate as an abstract concept describing the world in which we live, but its abstraction must not be assumed to be an idealization. The abstraction of “Unicity” as a concept is, rather, its virtualization—a virtual-reality through which the value of ideals, idealizations, essences, spirits, utopias, and so forth, is evacuated completely. [1] Accordingly, the Unicity is not just a concept that describes the world of globalization; the Unicity is the world of globalization, the world we inhabit. Framed in logico-poetic terms, the Unicity is the line at which metaphor, metonymy, analogy, symbol, identity, tautology, and contradiction cease to be different in concrete space.

    The emergence of the Unicity is indicative of a historical, structural shift in world order, typically denoted under the name “globalization.” Globalization is the process by which everything in the world approaches planetary scale: production, markets, architecture, society, life itself. But “planetary scale” by no means equals “massive” or “homogenous.” By thinking through the Unicity, we come to understand the proportion of the planet in terms of a unified “sliding scale” that extends from sub-atomic particles out to the movement of galaxies; the Unicity is, in a word, universal, but only because it operates both microscopically and macroscopically, locally and globally. The planetary scale of globalization is thus a means by which to measure movement across the world, from any location to any other. There is no difference in the Unicity—how can anything be different if all is One? Nonetheless there are movements—flows within networks, and flows across multiple networks. Thus, there must be a way to calculate movements across mutually embedded networks. The Unicity provides the scale by which network flows may be calculated as differential movement within a singular space.

    Stated another way, the Unicity is the line at which the world reaches absolute network integration, the mutual embedding of seemingly diverse informational networks into a complex systematic singularity. The Unicity is the “seam” or “border” between networks by which movement through one network with respect to movement across another network may be calculated and quantified. With respect to network integration, the Unicity may be thought of as the possibility of seamless measurability from one network to the next, making possible “leaps” from quanta to organic molecules to bodies to ecosystems to digital computer networks to cellphones to solar systems to economic/financial flows to warfare to linguistic translation to plumbing to garbage collection to academic publishing to whatever, ad infinitum, along a singular scale of measurement. Because movement is utterly measurable, the “leap” from one network to the next in the Unicity therefore becomes a “leap of confidence” rather than a “leap of faith.” Although any particular network may appear distinct or different from another, the Unicity allows movements within one network (i.e., network traffic) and movements within another network to be measured in tandem. Thus, although there are no differences per se in the Unicity, we must always consider the Unicity to be a differential system—a differential space.

    As such the Unicity is a form of virtual reality, but only in the following way: it is the seam uniting the concrete terrain of the planet and the virtual terrain of networked informational flows. The Unicity is therefore virtual reality because it is both virtual and reality. Perhaps we think of “virtual” in terms of “immaterial,” and perhaps this connotation occurs, at least in philosophy and critical theory, because the “virtual” has been coded to mean the “possible” (though “not necessarily actualized”). In today’s world order, however, we tacitly accept the virtual as both a real force and a commonplace aspect of daily life. Everything in the world has entered into the flow of informational networks: finance and communications, of course; but also transportation (we can go to anywhere from anywhere on the planet); energy (generated and utilized anywhere in the world); production (things can be manufactured anywhere and consumed anywhere); agriculture (food can be grown anywhere and eaten anywhere); and so forth. Ultimately, life itself has been informationalized and networked: the meaning of life is no longer a metaphysical question, but a physical process of metabolism (transmission of genetic information). The space of life (i.e., the planet) has been irrevocably altered by human production, to the point that it is no longer “natural,” in the true sense of “nature.” There is no nature left, only an ecological system, a singular network environment. All in all, we can think of the world in two ways: on the one hand there is the “rough” terrain of the world’s geography, and on the other hand, there is the “smooth” terrain of global informational flows. We tend to think that the “smooth terrain” of globalization covers the “rough terrain” of the planet, but this is not quite correct. The Unicity is the integration of “discrete” networks (such as listed above) into a singular network, a “network of networks.” But, recognizing the planet and life on the planet as networks themselves, the Unicity is also the borderline between the “rough” terrain and the “smooth” terrain: it is the line at which the informational world saturates the real world (rather than “covering” it). These two “hands”—the rough/real world on the one hand and the smooth/virtual world on the other—are in fact the same hand.

    There is no reason why this shift to globalization (the emergence of Unicity) has occurred; furthermore, there is no direction—finality—towards which globalization is heading. History no longer propels us forward (it does not “overdetermine our movement”) to an end, as if globalization were mandated by human progress. Just because things happen over time and space does not mean that things “progress” or “develop” or “perfect themselves.” It is clear for a variety of reasons, however, that certain changes in world order have occurred over time. The first change is from “traditional” societies to “modern” ones. Politically, “traditional” sovereignty—primarily European feudalism, but also other social orders in the Americas, Asia, Oceania, and Africa—was based on the right to kill; the Sovereign (king, lord, cacique) maintained social order by being able to decide if someone could die, either physically (execution) or symbolically (banishment). “Modern” sovereignty, at least as theorized by Foucault and Agamben, shifted into a “biopolitical” order; sovereignty is geared to the preservation and maintenance of life (bios) rather than the determination of death, in large part because every human is born (symbolically) with sovereignty over him/herself, a sovereign subject. The historical shift to biopolitics has been paralleled (leaping to the terms of Henri Lefebvre) by a shift from “absolute space” (one’s place in the world is determined by the divine cosmological order of the community) to “abstract space” (one’s place in the world is determined by one’s abstract relation to capitalist production). The Unicity would be a break with both biopolitics and abstract space in certain respects. In the space of the Unicity both the natural and the symbolic (spiritual) have been liquidated by the sheer physicality of networks; the natural gives way to the concrete, the symbolic gives way to the virtual, and all network systems are “anthropogenic.” In the order of politics, whereas “biopolitics” as it has heretofore been understood operates on the level of the phenotype, life-information in the Unicity operates on the level of the genotype. If politics are possible in the Unicity, they could only take the form of an intensified zoëpolitics, and hence a global ecopolitics. The question facing any possible political order with respect to Unicity is not whether individual organisms continue to live or die; it is the process by which life itself may be synthesized within flows of information.

    By describing Unicity as a “historical shift” in world order, then, one might be led to believe I am saying that a new political order has replaced an old one, just as a new spatial order displaced an old one. I am not saying this here. Although I do not discount Lefebvre’s theory of “differential space” as a new progression from “abstract space,” I cannot say that there has been progress from old to new, since what it “old” may very well remain contemporary to what is nominally “new” (Lefebvre, Space 352–400). The Unicity is not the “new world order,” but merely the way in which all the various flows across informational networks may be measured quantitatively. This atlas entry is only an initial attempt to establish a cartography of flows through the Unicity qualitatively.

    I have been reading one line of poetry for the better part of the last decade: “cidade/city/cité” (1963) by the Brazilian concrete poet Augusto de Campos (Fig. 1). This poem is both a map of the Unicity and a movement (flow) through the Unicity. At first glance the poem appears un-readable. It is a single line of letters that do not form any known lexeme, a composition of letters that convey no meaningful content. Upon closer inspection, however, we begin to notice certain amounts of order. Though not meaningful (yet), the letters are pronounceable, utterable. We begin to read, then, in fits and stops: “atrocaduca” to “ducapaca” to “pacausti” and so on. We then realize that the poem in fact consists of partial words—atro, cadu, capa, causti… vera, viva, uni, vora—and that these partial words have been ordered (for the most part) alphabetically. These partial words can therefore be “completed” by combining them with the poem’s title, which is attached, integrated into the poem at the end of its one line. The title serves as a “key” by which we can begin to read “atro-cidade,” “cadu-cidade,” “capacidade,” “causticidade”… “veracidade,” “vivacidade,” “unicidade,” “voracidade.” This string of lexemes can be instantly translated into three languages: Portuguese (just cited), English (atrocity, caducity, capacity…), and French (…veracité, vivacité, unicité, voracité). All of these terms (nominalized adjectives) may be used to describe a city, and in a sense the poem visually reproduces urban density in the way its letters mimic buildings pushed together in an urban core. But the “city” here is hardly a city at all, but just a suffix, an incomplete part of a word (-cidade, -city, -cité). In reality, this “city” is composed of language, of typography literally printed in the space of a poem. In reality, however, this “city” is also de-composed in language, since it generates a virtual list of words that may describe a city (but do not specify which city in particular they are describing). The string of lexemes generated by the poem, that is, does not exist in concrete space (the page) but only in the virtual space of reading.

    In the first iteration of my reading of Augusto’s poem (“Obverse Colonization”), I sought to show how the poem maps São Paulo, Brazil. Since the time of the Iberian conquests, Latin American cities have always been constructed with the idea of establishing order on the “barren” landscape of the New World. Initially the Latin American city was designed to be a harmonious space so that land could be “civilized” under the command of the Monarch and the Church. This civilizing mission was to be accomplished by a class of scribes—the “lettered city”[2]—who would maintain social, legal, and/or theological order through writing. Unlike the traditional Latin American city, however, São Paulo grew after 1870 as a modern city linked to international flows of goods (coffee), industrial production, and finance. Rather than the ordered, geometric grid of the colonial city, São Paulo grew without any cohesive urban planning around the disordered lines of factories, railroads, and favelas; the city emerged around sites that both generated great wealth and concentrated unspeakable poverty and exploitation. Augusto’s modernist poem therefore disrupts the world order initiated by the conquest of the Americas. Veering sharply from traditional stanzaic formats, it is at once an illiterate poem that cannot be read, and a hyperliterate poem that can be read in three languages simultaneously. The one line of the poem marks a borderline between illiteracy and hyperliteracy through which a city-space is generated, much in the way modern São Paulo emerged from the relation between “hyper-wealth” and “hyper-poverty.” By operating in the primary languages of the “developed First World” (English and French), the poem would seem to be inserting “underdeveloped Third-World” Brazilian Portuguese into the league of developed nations. The poem would seem to insist on bringing Brazil “up” to the First World. In fact, just the opposite occurs: because information is instantly translatable between the three languages, the poem allows the “transfection” of the hyperliterate/illiterate relation (typical of “underdeveloped” nations) across the globe. The poem is in fact about colonization—the “coloniality” of space, language, law, and thought[3]—and yet its mode of colonization operates from the “obverse” direction than we might expect historically.

    Augusto’s poem therefore marks an “internalized” border in the center of São Paulo through which the city has emerged as a global city. The poem maps a borderline between hyperliteracy/illiteracy, development/underdevelopment, wealth/poverty, but this map does not demarcate the territory of one as separate from the territory of the other. The poem does not demarcate a space-within from a space-without. Rather, the poem works as an “internalized” border, drawn within the city of São Paulo, to demonstrate how hyperliteracy/illiteracy, development/underdevelopment, wealth/poverty are all conjoined, co-dependent, united. But once the border has been internalized, where do the city limits end? Augusto’s poem maps the point at which the city limits reach infinity. In other words, São Paulo is “global” insofar as its city limit, being internal, has no external bounds. The “city” mapped by the poem is no city at all, but may effectively spread across the entire planet.

    The poem suggests that its form of order may be replicated and translated on a global scale. “Order” in “cidade/city/cité” is established by the alphabet of Latinate script. Yet there are instances in the poem when alphabetic order is disrupted. Indeed it may be the case that the poem is fundamentally disordered alphabetically. The most notable instance of disorder is the title itself: “cidade” (or “city” or “cité”) does not follow alphabetically from “vora” (the last “stem” in the sequence of the poem). Of course, in the poem “-cidade” is utilized as a suffix, rather than as a lexeme meaning “city,” in which case we might say that all that matters are the ordered prefixes (atro-, cadu-, etc.) comprising the majority of the verse. However, although titles usually stand distinct from their poems, in this case the title flows directly from the poem—so that “stems” ordered by the letter “v” lead directly into terms in the letter “c,” suggesting a disruption in the alphabetical order of prefixes. The “cidade” also marks a physical disruption in the shape the poem, shifting the line from a horizontal axis to a vertical one.

    Another instance of disorder occurs amongst the prefixes themselves: “velocity,” “veracity,” “vivacity,” “unicity,” “voracity.” This particular segment of the lexical string raises questions regarding the truth (veracity) within flows at maximum speed (velocity). The truth is linked to two distinct descriptions of life: the positive energy of living, the life force (vivacity); and destructive needs, consumption of flesh, the violence of life (voracity). The truth speeds between these positive and negative nodes of life in that the poem files the four terms together under the index of the letter “v.” However, this scripted (if not scriptural) index is disrupted by “unicity.” The “unicity” jumps out of alphabetic order, even though the poem itself is a map of a unified urban space. Or rather, the truth of the matter is that the Unicity marks the border between the desire for life (vivacity) and the needs of life (voracity), and marks the transition from one kind of order to another, from linguistic order (lettered city) to the order of translation, information flow, the urban.

    The real fact of the matter, however, is that there is very little alphabetic order in the poem at all. Recall that the alphabetic string of lexemes can only be created virtually. Translation of meaningful content can therefore only occur virtually. But this virtual, meaningful, and non-tactile reality can only be generated by dividing the one line of letters that actually exist on the page (or the screen or wherever) into discrete units: atro, cadu, capa, causti, dupli, elasti, and so forth. Yet nothing in the poem actually mandates that its single line of letters be divided in this way. We could just as easily divide it thus: at, roca, duc, apaca, u, stid, upliela, st, ifeli, etc. Seen this way, we must only understand that the majority of the poem has no alphabetical order in the slightest, and thus no meaningful content, and thus no possibility of being translated. The poem, which is both hyperliterate and illiterate simultaneously, is also simultaneously translatable and untranslatable. The poem establishes a syntactical chain from illiteracy to underdevelopment to poverty—just as is done by global agencies such as UNESCO, the World Bank, and myriad Non-Governmental Organizations (NGOs). But it does not create this syntax in terms of an exclusion from order and power. Rather, illiteracy and poverty are included in the order and language of power—as the untranslatability of order.

    The Unicity is exactly what it says it is: a Uni-City or One City that covers the globe. We still assign individual names to “different” places, of course, but in fact the world is now a singular city, or more precisely a singular urban network. [4] Accordingly, world order is no longer constituted by “centers” and “peripheries,” “First World vs. Third World,” relations of “inside” vs. “outside,” or similar binary relationalities. Globalization is a structural shift in world order, then, in the following way: at some historical threshold in the recent past, it is as if the relation between “interiority” and “exteriority” (which constituted the bourgeois-capitalist order of nation-states) collapsed or imploded into itself. This implosion produced an “internalized” border within the city (any city, all city), no longer demarcating a territory-within from a territory-without, but only a singular vanishing point at which the city limit reached infinity. The Unicity is therefore an “internalized border,” but one that works to territorialize the entire planet as absolute exteriority. Although many have concluded that this exteriority of globalization represents a “smooth” or “homogenous” space of global capitalism, this is only partially correct. We live in and walk through the material, physical space of the planet, what we can call “concrete space.” The “globe” of globalization, however, at first appears to us as immaterial, invisible, non-tactile; it is the movement of information across networks by which the world becomes “anthropogenic” or engineerable by human society. This “anthropogenic” globe we can call “virtual space.” In fact, there is no difference between concrete and virtual space; if we can make a distinction between them, it is only to envision how virtual space saturates concrete space, and vice versa. The Unicity is the border where this saturation occurs, the seam at which concrete and virtual realities come into contact and merge.

    The Unicity is therefore not a place in the usual way we think of “placement,” but rather a border-zone from which spaces of translatability or untranslatability may be generated. But where does the generation of urban space occur? At first glance “cidade/city/cité” resembles nothing so much as a genetic sequence as conventionally symbolized as combinations of “C-T-A-G” (the bases Cytosine, Thymine, Adenine, Guanine):

    TGCAGCCTCAACCTCGTCAGGCTCAAGCAATCCTCCCACCTCAGCCTCCA
    GAGTAGCAGGGACGATAGGTGTGCACCACCATGCCCAGCTAATTTTTGT
    ATTTTTTTTTCTTTTTTTGAGATGGAGTCTTGCTCTGTTGC.
    (National Center for Biotechnology Information)

    This is a fortuitous coincidence, but it is not meaningless. In reading Augusto’s poem—the city—we have already entered into the process of enzymatic reading.

    We can now think of cells and the molecules in them—by which I mean to say, any living cells including the ones in your body right now—as media for the transmission of information. In biochemistry, in fact, this is called “information metabolism,” which can be defined as “the storage, retrieval, processing, and transmission of biological information” (Matthews, Holde, and Ahern 876). Information metabolism is the use of a nucleic acid (either DNA or RNA) as a template for the synthesis of proteins or other nucleic acids (another DNA or RNA molecule). As such, information metabolism has three distinct processes: DNA replication, DNA transcription, and RNA translation.

    When DNA replicates, a set of enzymes (topoisomerases, helicase, and primase) “unwinds” and “stretches” the DNA molecule, which is normally coiled up in a double-helix. These enzymes effectively open a “fork” between DNA’s two strands. Another set of enzymes (polymerases) then “runs through” and “reads” the genetic information sequenced on each strand; as the polymerases run through their reading they create a complementary strand for each, thus forming two “daughter” DNA molecules. DNA replication is thus the use of DNA as a template for the synthesis of duplicate DNA molecules. DNA transcription, by contrast, is the use of DNA as a template for the synthesis of RNA. In transcription, another kind of polymerase (RNA polymerase) “reads” the sequences of base pairs (C-T, A-G) coiled into the DNA molecule and “generates” a single-stranded RNA molecule. Initially this RNA has both “meaningful” bits of genetic code (called exons) that will ultimately be used to create proteins, but it also has “meaningless” bits of genetic code (called introns). These “meaningless” introns are spliced out of the RNA, so that transcription results in the production of what is called messenger RNA (or mRNA) that is only composed of “meaningful” exons. During RNA translation, finally, the mRNA serves as a template for the synthesis of proteins—the “stuff” of which all the cells in your body is composed. In RNA translation, mRNA is conjoined to a transfer RNA (or tRNA) by means of a rizome. In essence, the rizome uses tRNA as a kind of genetic dictionary so that information on mRNA can be transferred into a new medium—the amino acids that are chained together to form proteins.

    My point in this digression on information metabolism is not to belabor the details of genetics, but only to show that biochemical metabolism has now been shown to involve processes through which information is replicated and transcribed into a useable form, and then translated into content (in the form of proteins, the “stuff” of which your body is actually made). Life as we know it has been transposed into information, and this information is replicatable, transcribable, and translatable. Through understanding and describing “natural” molecular-biological processes, molecular biology has effectively worked to “nest” genetic molecules in a virtual informational matrix. The map of this virtual matrix, in fact, is readily accessible online through the US National Institutes of Health now that the Human Genome Project has been completed. This does not mean that the life of your cells has been engineered by human hands, only that your human hands are formed by an informational process that is now potentially engineerable by and for human society. Just because science has infused biological systems with information, and then generates more information through experimentation, does not mean that science or scientific knowledge is always-already reductive or false. Rather, the living organism has come to be understood (and utilized) as part of an environmental system in which “natural” life and “human” knowledge recombine into one another. There is no distinction between artificial and natural here, because all “natural” systems (not just biological ones, but also environmental and climatological systems) are potentially “engineerable,” thus rendering them open to social regulation.

    In one sense, then, the human body is composed of cells. In another sense, each cell is a network of information, and information in one cell is networked to all others to form a body. The information in the cell, moreover, is in a constant state of decomposition and translation. In fact, when decomposition and translation reach a maximum they result in uncontrollable growth—cancer—that quickly becomes a social condition to be managed by other networks (health care systems, medical technology, pharmaceutical research, government, education, religion, family, and so forth).

    It is fortuitous, therefore, that the title of “cidade/city/cité” operates as if it were an enzyme for the reading, replication, transcription, and translation of a sequence of letters. Fortuitous, but not mistaken. A reading of the poem allows us to “leap” from the urban network of the Latin American city to the urban network of globalization to the metabolic network of cells, as if all these networks pertained to a singular network environment. The “city” (Unicity) is nothing less than the environmental system of life generated by the saturation of the environment by information—information that flows across networks mutually embedded into each other. The border of this city is internalized: it is the border that opens between one strand of DNA and the other during replication.

    The Unicity is a space of both composition and decomposition. Likewise, it is a space defined by relative (differential) flows of translatability and untranslatability. Across this space there are densities of informational flow, zones where data-streams are particularly dense. Although these densities are the same quantitatively (all are data, information), they may differ qualitatively (there are differential flows of data). Some network densities channel information that is highly translatable across the Unicity; other network densities channel information that is highly untranslatable. Following from the DNA transcription of exons and introns, the space of the Unicity is de/composed of zones of dense “meaningful” content (translatable content) that I will call exones, and zones of dense “meaningless” content (untranslatable content) that I will call intrones. Both exones and intrones are necessary for the structural (emergent) stability of the Unicity, although it is not yet clear why this is the case.

    What is clear is that translatability in the exone tends to reach a maximum when economic interests (i.e., greed) are most intense. This has become painfully clear in the recent financial crisis of 2008–09. From the standpoint of global economic order, it has become commonplace to see the world in terms of network “flows” (cf. Castells’ “space of flows” to be discussed shortly). Capital has become informationalized—it is digital “content” that can be moved around the planet at almost the speed of light. With increasing force and dexterity since 1990, the informationalization of capital has allowed capital to flood into any market that is “hot.” Moreover, it has allowed the creation of incredibly complex derivatives designed to capitalize instantaneously on the movement of capital into “hot” markets, and to leave these markets just as instantaneously once they “cool.” As Manuel Castells has written, derivatives “operate to recombine value around the world and across time, thus generating market capitalization out of market capitalization” (104).

    Unfortunately, as it has been made painfully evident recently, derivatives also generate market de-capitalization out of market de-capitalization. The prime example of this is the United States housing market since 2000. Because it could be moved at the push of a button (literally), capital from across the planet flooded into the US real estate market faster than federal regulators of this market could manage—or rather, faster than they cared to manage, since the official policy of the US federal government encouraged the flood. Capital, in other words, moved into the real estate market virtually. Capital then worked to transform real estate into virtual estate: mortgages were bundled into massive bonds (derivatives), so that real property was essentially capitalized into virtual quantities (mortgages) that could then be used as collateral for further loans (bonds); in essence, banks issued loans, and then used these loans to borrow other loans, and then used these collateralized loans to take out even more loans. Banks then bought and sold these derived loans (in the form of bonds, collateralized debt obligations, etc.) from/to other banks, so that for every US$1 of real capital loaned out upwards of US$30 of capital was “created” virtually. Of course, when the value of real estate declined sharply and people defaulted on their mortgages en masse, the 30:1 ratio for profit turned into a 30:1 ratio for debt, and capital evaporated from the entire global market instantaneously.

    Virtual gains instantly became virtual losses, and this proved to be a real problem. Since 1980 all financial activities worldwide have been networked. Thanks to the repeal of Depression-era safeguards against consolidation, financial institutions merged into one another. Behemoth financial institutions, housed in command-and-control centers (e.g. the skyscrapers of Lower Manhattan) could operate in consumer and commercial banking, securities markets, insurance, hedge funds, and any other financial activity of their creation. All of these activities were also digitized over the same time period, so that transactions could be “managed” automatically by complex algorithms over digital information networks. The informationalization of capital further allowed behemoth financial institutions to network themselves globally. In practice, all financial institutions across the globe loan each other capital to cover their daily operating expenses, facilitated by the grand instrument of digital networks. In theory, these loans should be guaranteed by other instruments like hedge funds and collateralized debt obligations. In the case of the current financial meltdown, however, financial institutions were also profiting (virtually) by issuing, buying, and selling these “guarantees.” Thus, the more global capitalism “insured” itself virtually, the more capital virtually evaporated once the crisis began. And since financial institutions operated day-by-day by loaning capital to one another, the mass-scale disappearance of capital virtually threatened the viability of the entire market.

    Global financial networks were designed in order to mitigate risk. Because capital has become informationalized, it may be withdrawn from one investment instantly and reallocated to another more profitable investment. Derivatives, moreover, were created as a hedge against risk, so that if one aspect of the market dropped profit could still be generated “on the back-end” from that drop. The current financial meltdown has demonstrated that the informationalization of capital has not yet eliminated the possibility of miscalculating risk, however. On one hand, powerful capitalists working from the exone may deliberately falsify data and then translate that falsified data throughout the system faster than can be regulated. On the other hand, and more importantly, the exone of financial networks is dependent upon intrones, and yet has no means of calculating the flow of information through intrones. In fact, “intronic” flow cannot be calculated because it is untranslatable. Thus, mortgages are issued to denizens of the introne, even though terms of the agreement are not communicable between exone and introne; financial and corporate exones draw upon the labor power of the introne; “natural” resources and energy are drawn from the introne. But the risk of dealing with intrones in this way cannot be prognosticated.

    Financial flows can and must be regulated, however. That is, power in the Unicity exceeds the power of governments and international agencies, yet the Unicity still requires governments and international agencies for the regulation and maintenance of networks. For finance to flow, after all, monetary policies have to be set in place and ordered. Global corporate structures require some institution to ensure that contracts are enforced, that assets are fungible, and so forth. In this sense, the Unicity is a historical shift in world order, a step above the order of modernity, industrial modernization, and the modern nation-state. But the Unicity is not a progression from the old order, as if the power of the nation-state had been totally liquidated. Nothing could be further from the case; in fact, the power of the nation-state may be magnified in certain respects. History needs to be re-written in this way: The bourgeois-capitalist nation-state evidently succeeded the theological order of the Catholic church; but this never meant that the power of theological order waned, as evidenced by the incredible power exerted by religion over the world. The same will be true with the nation-state. Why? History and juridico-political paradigms are now just informational networks, to be networked into the “network of networks” that is the Unicity. The risks posed by the informationalization of history, theology, and capital cannot yet be properly calculated or prognosticated.

    By linking exones and intrones, the Unicity marks the borderline between the desires of life, perceived as an immaterial life force (vivacity); and the bare necessities of life, hunger, the need to eat, the need to destroy one body so that another may live (voracity). The Unicity links desires and needs so closely that they become indistinguishable. But what are the legal and political consequences of this indistinguishability?

    In thinking through an answer to this question, the worst mistake that could be made is to think of exones in terms of inclusivity, versus intrones in terms of exclusivity. There are real modes of disaffection, disempowerment, and exploitation in the Unicity, but none of these has anything to do with binary relations of inclusion/exclusion. Since exones and intrones are bound together as co-dependent relations of production, both are “included” in the space and flows of the Unicity. [5] By including all into a singular oneness, the Unicity functions only in terms of absolute exteriority. Everyone and everything is always already “outside.”

    This absolute exteriority alters how we must think of power and relations to power. Once everything is on the outside, there can be no such thing as transcendence, at least not as some metaphysical Being that inheres in physical matter. This should be welcome news to most practitioners of deconstruction: there is only physical matter in the Unicity. The unwelcome news for practitioners of deconstruction is this: there is only physical matter in the Unicity. Just as there is no transcendence in the Unicity, neither is there such a thing as immanence. Just data. The problem of course is that no institution of political power has ever been formed around streams of data. Politics have only been constituted through either transcendence (as in, heavenly order handed down through popes and kings based on the presupposition that we all have souls), or immanence (as in, all subjects are born with inherent powers that they can choose to represent rationally in the form of a republic or nation-state). Having no sense of transcendence or immanence, it is not clear how law can be enforced in the Unicity—or more precisely, by what force-of-law (nomos) legal powers could be deemed legitimate.

    The Unicity is anti-nomic space in this regard, and this poses all sorts of problems for political and legal philosophy. Clearly, in terms of politics, law, and governmental organization, the Unicity represents a historical and structural shift in world order. Once the validity of both transcendent and immanent modes of subjectivity has been evacuated, it would seem that a new mode of subjective power (and/or subjugation) would be on the horizon. But this horizon will not arrive. Why? Most philosophers, theorists, and critics (operating in the exone, after all) assume a strict periodization in which the history of world order is the succession of juridico-political paradigms. Thus, Europe moves from the Roman Empire to the order of the Catholic Church; with the discovery of the Americas, the power of the Church wanes and gives way to the modern system of nation-states. The days of the nation-state are now thought to have come to an end…giving rise to what?

    To my mind, Giorgio Agamben has come closest among contemporary political philosophers to providing an answer. Following from Carl Schmitt and Michel Foucault, Agamben seeks to theorize the “new” nomos of the planet (the force of law over the globe). Agamben knows that this nomos is biopolitical, directed to the incorporation of “bare life” (zoë) as political life (bios). As biopolitics—the orientation of politics towards the preservation and maintenance of life—emerges as a primary aim of the nation-state, national order paradoxically enters into crisis. In order to preserve the force of law and hence to preserve life in times of crisis, the nation-state finds it must suspend its own laws; the force of law (nomos) demands the force of law, the state of exception. “It is produced at the point at which the political system of the modern nation-state, which was founded on the functional nexus between a determinate localization (land) and a determinate order (the State) and mediated by automatic rules for the inscription of life (birth or the nation), enters into a lasting crisis, and the State decides to assume directly the care of the nation’s biological life as one of its proper tasks” (Homo Sacer 175).

    If I understand Agamben correctly in the totality of his work, the order of the nation-state enters into crisis because, although it is founded on the symbolic-metaphysical inscription of life into politics, the State can never properly translate the bare physicality of life into symbolic-metaphysical terms of citizenship. The state of exception is the limit between this “metaphysicality” and “physicality,” the point at which the two would unite; the biopolitical imperative thus mandates entrance into the state of exception. Yet the state of exception only marks the transition of the biopolitical imperative into a “thanatopolitics,” whereby sovereign power may execute bodies at will. In this respect, the Nazi concentration camp becomes the primary emblem of the crisis of national nomos and the supposed entrance into the new nomos of the planet:

    The state of exception, which was essentially a temporary suspension of the juridico-political order, now becomes a new and stable spatial arrangement inhabited by the bare life that more and more can no longer be inscribed in that order. The growing dissociation of birth (bare life) and the nation-state is the new fact of politics in our day, and what we call camp is this disjunction. To an order without localization (the state of exception, in which law is suspended) there now corresponds a localization without order (the camp as permanent space of exception). The political system no longer orders forms of life and juridical rules in a determinate space, but instead contains at its very center a dislocating localization that exceeds it and into which every form of lie and every rule can be virtually taken. The camp as dislocating localization is the hidden matrix of the politics in which we are still living, and it is this structure of the camp that we must learn to recognize in all its metamorphoses into the zones d’attentes of our airports and certain outskirts of our cities. (Homo Sacer 175)

    In order to preserve the life of its “People,” the nation-state establishes an external territory it inhabits with bodies stripped of citizenship, a zone composed of bodies that may be voided without any possible legal ramification, no protection against homicide or genocide. This new space, in which life can no longer be inscribed into juridical order, transforms into a space of permanent displacement that “virtually takes” the globe. Agamben concludes, “The camp, which is now securely lodged within the city’s interior, is the new biopolitical nomos of the planet” (Homo Sacer 176).

    It is precisely on this point that Agamben’s theories falter: in the Unicity, there is no such place as “the city’s interior,” only global exteriority. Agamben certainly helps us to see how the historical shift to Unicity occurs. Nevertheless, he tends to equate historically produced spaces incorrectly. His temptation is to see in “Third World” zones like the favela or the maquiladora slum a direct analogy to the Nazi concentration camp. From the standpoint of network integration, the favela and maquiladora slums—intrones—are far more nuanced and complex than the concentration camp. This is not a comparison of relative degrees of pain and violence, which would be utterly pointless and disgusting. Rather, I am merely stating, first, that intrones are not zones of exclusion, that they are thoroughly inscribed into the world order of Unicity as the untranslatability of information. But the Unicity, second, is not a juridical-political space in the way Agamben thinks of nomos. Agamben’s main blind spot is that in envisioning the absolute decline of one kind of sovereign nomos, he assumes it to be replaced by a new nomos. But the Unicity is not that.

    The global city has been understood as a “space of flows,” in which goods, services, and people are eminently translatable. As Manuel Castells defines the “space of flows”:

    The informational, global economy is organized around command and control centers able to coordinate, innovate, and manage the intertwined activities of the networks of firms. Advanced services, including finance, insurance, real estate, consulting, legal services, advertising, design, marketing, public relations, security, information gathering, and management of information systems, but also R&D and scientific innovation, are at the core of all economic processes, be it in manufacturing, agriculture, energy, or services of different kinds. They all can be reduced to knowledge generation and information flows. Thus, advanced telecommunications systems could make possible their scattered location around the globe. (409–10)

    The networks Castells mentions can be located anywhere on the planet, facilitated not only by telecommunications networks, but also transportation (air, ground, sea) networks. Large corporations can therefore distribute their various functions to any locale on the globe that offers the most advantageous cost-benefit. The most notable effect of the space of flows—notable in the sense that it has received the most critical attention—is the emergence of the global city. The global city is not only a command-and-control node in the global network, but also a city in which urban life (culture) resembles that of any other global city. Thus we now have cities in far-flung locales, such as Los Angeles, New York, Tokyo, London, São Paulo, Bangkok, which all seem to offer the same urban existence—a translatable urban existence. This view of the global city, however, is only partially correct, because the “global city” is in fact partial—it is only a part of any of the places just mentioned. The evident homogeneity of urban life in global cities is of limited interest, however.

    The historical transition from the “space of places” to the “space of flows” is far more significant than the emergence of global cities per se. That is, we have traditionally thought of city space as a place defined by a bounded center (or centers) of densely packed buildings, surrounded by houses and smaller buildings, surrounded by countryside. The space of places is one held within external city limits. We have traditionally defined “city,” furthermore, according to a spatial model of centers and peripheries; this model has been extended to the world order of modern geopolitics, which was composed of “central” rich industrialized nations and “peripheral” poor dependent or agrarian nations. Yet the “center-periphery” model assumes a static kind of space, one that can be surrounded by a borderline because space is thought to be fundamentally motionless. In the space of flows all that matters is the movement “through.” Data flows in, data is processed, data flows out. Capital flows in, capital is processed, capital flows out. Planes fly in, planes are processed, planes fly out. I turn on my computer (electricity flows in), I process words and send an email, I turn off my computer (electrical flow halts). Thus, it matters less that a static space can be defined as a “place” or an “area,” and more how things and bodies transit through space. From this perspective it becomes clear that “city” is network of networks: not only corporate services networks, but also water, energy, food, culture, and so on, all of which transit through space, hopefully through ordered channels (but certainly not always).

    The space of flows has been theorized with greatest precision by one of Augusto de Campos’ contemporaries in São Paulo, the Jewish/Prussian/German/Czech/Brazilian philosopher Vilém Flusser. In “The City as Wave Trough in the Image Flood,” Flusser seeks to re-image space:

    We are accustomed, for example, to see the solar system as a geographic place in which individual bodies orbit around a larger one. We see it as such because it has been shown to us in images, not because we have perceived it with our own eyes. However, today we also have other images at our disposal. Here is one that shows us the solar system as a network of wire netting, as a gravitational field, and in this netting there are sacklike wells in which the wires are more tightly knotted together. In one of these wells we recognize our Earth once more because built into this sack there is a smaller body, namely, our moon. Both of these images of the solar system are models rather than maps. And certainly the second image is more useful for a trip to Mars than the first. In the second image one sees that one must first crawl up out of our well and then be careful not to fall into the sun’s well in order to finally fall into the Mars well. The same is true of the image of the city. When we are talking about a “new urbanism,” it is more useful to construct the image of the city as a field of flections. (323)

    The first model of the solar system as “geographic place” corresponds to a “traditional” center-periphery model of urban space that Flusser seeks to surpass: “The typical image we construct of the city looks something like this: houses as economic private spaces that surround a marketplace, the political public sphere, and over their on a hill stands a temple, the theoretical sacred space” (323). In essence Flusser describes the idealized image of classical Athens as a public sphere of ideal relations between citizens (polis) engaging one another on a public marketplace (agora) before returning home to private space (oikos).

    This classical urban order no longer exists. In the contemporary “space of flows” (Castells’ term) of the Unicity (my term), this image of city as composed of discrete, bounded places cannot hold. The city, argues Flusser, becomes a “confusion of cables” in which public political and economic relations are literally piped into private living spaces and piped back out again. Instead of discrete spaces and places, then, there are only intersubjective flows of information. I will quote Flusser at length:

    We must imagine a net of relations among human beings, an “intersubjective field of relations.” The threads of this net should be seen as channels through which information like representations, feelings, intentions, or knowledge flows. The threads knot themselves together provisionally and develop into what we call human subjects. The totality of the threads constitutes the concrete lifeworld, and the knots therein are abstract extrapolations. One recognizes this when they unknot themselves. They are hollow like onions. The Self (I) is an abstract, conceptual point around which concrete relations are wrapped. I am that to which you is said. An image of humanity of this type is obvious not only thanks to psychoanalysis and existential analysis but corresponds also to the concepts of other areas, for example, ecology (organisms are knottings together of ecosystems); molecular biology (phenotypes are knottings together of genetic information); or atomic physics (bodies are the knottings together of the four field strengths). If one holds fast to the image of an intersubjective field of relations—we is concrete, I and you are abstractions of this—then the new image of the city gains contours. It can be imagined roughly in this way: The relations among human beings are spun of differing densities on different places on the net. The denser they are, the more concrete they are. These dense places develop into wave-troughs in the field that we must imagine as oscillating back and forth. At these dense points, the knots move closer to one another; they actualize in opposition to one another. In wave-troughs of this type, the inherent possibilities of relationships among humans become more present. The wave-troughs exert an attraction on the surrounding field (including the gravitational field); ever more intersubjective relationships are drawn into them. Every wave is a flash point for the actualization of intersubjective virtualities. Such wave-troughs are called cities. (325–6)

    Writing before the expansion of the Internet, it is remarkable how clearly Flusser theorizes social networking—allowing us to see what must have been wild abstract images in Flusser’s day as normal parts of daily life. Now writing after the expansion of the internet, however, I must expand and modify several of his claims here. First, Flusser is correct to image the city as a density (a wave trough) of intersubjective informational flows. In such an image each subject (Self) is merely a density of information (a “knot”) with respect to another knot (Other); each knot exerts a kind of force with respect to all others, such that if enough informational knots agglomerate together they form a “deep” density we call a “place.” In this sense there is no such thing as subjective identity, at least in the sense of an immanent identity that inheres within an individual body. Rather, there are only relations between informational densities that may be abstracted as individual subjects. In other words, in the Unicity subjective identity is always displaced into the network(s) of informational flows, so that subjectivity per se is only experienced in the differential movement between one “density” and the next. However, the networks in the Unicity are not just human or subjective; human bodies become informational networks (information metabolism, for instance), but so do buildings, air, water, computers, plastic, book. Thus, we must view subjectivity in the Unicity in terms of interobjective fields of relations—how “subjective” information flows across object-networks.

    Second, to this end Flusser views his “city” (the Unicity) as a kind of marketplace where “masks are lent out” (324). Since the “Self” is like a hollowed-out onion, subjects move through the city by projecting masks to one another. What Flusser calls a “mask,” we could rightly now call a “username” or “avatar.” In order to transit through networks, we are often called upon to prove our identities; we then produce a virtual image of our identity and guarantee this image with a unique signature or password. If the network cannot verify this virtual identity, then we are not allowed to pass through. Thus, I can check my email, voicemail, bank accounts, and use a credit card or passport anywhere in the world, so long as my avatars are verified.

    This flow of masks is precisely what Marc Augé has theorized as the “non-place” (non-lieu). It used to be the case that one’s identity was guaranteed by a sense of place: perhaps one’s village assigned one’s place in the community, in the world of men, and in the world of gods (absolute space); or, perhaps one’s inherent sense of self united one to other selves (abstract space). In any event, one could always know one’s Self just as others could recognize each other. According to Augé, however, we now routinely move through spaces (non-places) in which one’s anonymity (rather than known identity) is constantly affirmed. Paradoxically, we are continually required to demonstrate our identities: we show our passports, swipe our credit cards, type in our passwords. Only by doing so, however, are we allowed to proceed on our way as anonymous subjects whose movement through space (a shopping mall, a road, an airport) does not have to be questioned. Augé, just like Flusser, theorizes a world in which we carry multiple forms of identity, each of which has been displaced into an objective network of informational flow. How else could we possibly explain identity theft? If our identities were locked inside our bodies (placed there), how could some other anonymous being steal our identities (now displaced to some network non-place) and operate as if they wore masks of our faces?

    Flusser and Augé are incorrect, however, in that both find all “masks,” “identities,” and “non-places” to be of equal measure. All subjects wear masks that hide all identities so that all anonymous subjects may transit through all non-places. If we now turn back to Augusto de Campos’s poem, we will recall that the “cidade/city/cité” is simultaneously translatable and untranslatable; the city is a singularity (a single line), but it flows through the differential movement of “hypertranslation” and “non-translation.” The Unicity, then, is the unbounded informational/urban terrain of the planet; but far from a “smooth” globe, the Unicity is pock-marked by densities, troughs, knots, black holes, across which information may flow quickly, slowly, or become suspended like fuzzy static charge (noise). Assuming the “leap” between genetics and urbanization as argued earlier to be possible, we should recall that in RNA transcription, “meaningless” content (introns) must be spliced out of mRNA leaving only “meaningful” content (exons) in order for RNA translation to proceed. Similarly, the terrain of the Unicity is marked by differential spaces of “content”: exones and intrones. Since the Unicity is both urban space and informational network, I would define “exones” more precisely as demographic concentrations with network densities of which information tends to be immediately translatable throughout the Unicity. By contrast, “intrones” may perhaps be more demographically dense than exones, but they are less dense informationally, because information in the introne is not as readily translatable as meaningful content across the Unicity. Exones are informationally “rich” (global wealth); intrones are informationally “poor” (global poverty).

    One’s ability to flow through an exone is maintained by protocols of subjective identification: one must have avatars (e.g., credit cards, passports, numbers) that can be verified by the network; otherwise one simply “does not make sense” to the world, and one “habits” an introne. By the same token, the introne may co-opt identities in the exone, whether deliberately or not, and thereby circulate with absolute anonymity. In any case, the borders between wealth and poverty, exones and intrones, may be demarcations between neighborhoods within a single urban area; the lines of dependency between these zones are still in effect, of course, by which I mean that “global wealth” and “global poverty,” exones and intrones, are co-dependent relations through which global urban space is produced. The Unicity demarcates the entire world as a global border zone.

    The border of this global border zone, however, does not demarcate one geographic (geopolitical) territory from a different territory. The border that is the Unicity cannot therefore legitimate that which belongs to one territory as opposed to that which belongs to an Other. Here there is no question of legitimacy or illegitimacy, because the Unicity is fundamentally a-legitimate; no legality or illegality, because the Unicity is fundamentally extra-legal; no civilization or barbarity, just users, denizens, avatars, and/or pirates. So what does the border that is the Unicity demarcate and territorialize? By stating that the globe is singular urban space of network traffic, we are stating that everything has become informationalized. Since “we” are only really information, there is no difference between a “Self” and an “Other.” There are only relative densities or diffusions of network traffic (you are only a density of network traffic, and so am I).

    The border therefore constitutes and distributes relative degrees of translatability—but how? This is the most difficult question raised by this present Atlas entry, one that I hope to have answered if only partially. As I see it, translatability must be guaranteed by certain protocols, or sets of protocols, so that a user/denizen might be able to enter and exit an exone with a particular identity (avatar) intact. These protocols are established—for no other reason than the fact that it so happens to be the case—by pre-existing social institutions. Thus, there is no force of law—no nomos—in the Unicity whereby such things as legality, sovereignty, citizenship, or subjectivity might be constituted as legitimate. There is no such thing as a “global citizen” because citizenship per se is precluded in the Unicity. There are no citizens, just denizens and avatars. Citizenship is a category determined by immanent subjective power, but identities are not produced immanently in the Unicity. Rather, bodies are merely phenotypes of genotypical information. As such, identities are merely verified, transcribed, and translated (or unverified, untranscribed, and untranslated) across informational networks. There can be no symbolic “People” for a State to govern—just data, streaming through bodies. And yet social institutions—States—are still required to monitor and maintain network traffic and protocols.

    On the one hand, then, the Unicity is neither nomos nor anomie, but rather anti-nomic space. On the same hand, however, the Unicity is still a legal, political, and above all, zoëpolitical space, in that it requires—feeds off of—extant sphere(s) of nomos. The Unicity is a singular physis that evacuates the metaphysical foundation of nomos, by recombining itself into the physical residues of pre-existing nomos. If the physis of the Unicity retains a parasitical (and hence destructive) relationship with extant nomos, life in the Unicity nonetheless still depends upon just “so much” of laws, protocols, legitimations, contracts, enforcements, and/or subjectivities guaranteed by nomos. Having no nomos for itself, the Unicity nonetheless operates recursively, retroactively…the retronomos of the globe.

    Buffalo, USA / Kolobrzeg, Poland

    Works Cited

    • Agamben, Giorgio. Homo Sacer: Sovereign Power and Bare Life. Trans. Daniel Heller-Roazen. Stanford, CA: Stanford University Press, 1998.
    • ---. State of Exception. Trans. Kevin Attell. Chicago: The University of Chicago Press, 2005.
    • Augé, Marc. Non-Places: Introduction to an Anthropology of Supermodernity. Trans. John Howe. London: Verso, 1995.
    • de Campos, Augusto. “cidade/city/cité.” Viva Vaia, Poesia 1949–1979. São Paulo: Editora Brasiliense, 1963. 115.
    • Castells, Manuel. The Rise of the Network Society. Malden, MA: Blackwell Publishing, 2000.
    • Flusser, Vilém. “The City as Wave-Trough in the Image-Flood.” Trans. Phil Gochenour. Critical Inquiry 31 (Winter 2005): 320–8.
    • Foucault, Michel. Society Must Be Defended: Lectures at the Collège de France, 1975–1976. Trans. David Macey. New York: Picador, 2003.
    • Hardt, Michael and Antonio Negri. Empire. Cambridge, MA: Harvard University Press, 2000.
    • Lefebvre, Henri. The Production of Space. Trans. Donald Nicholson-Smith. Malden, MA: Blackwell Publishing, 1991.
    • ---. The Urban Revolution. Trans. Robert Bononno. Minneapolis: University of Minnesota Press, 2003.
    • Matthews, Christopher K., K. E. van Holde, and Kevin G. Ahern. Biochemistry. 3rd edition. San Francisco: Addison Wesley Longman, Inc., 2000.
    • Mignolo, Walter D. “The Geopolitics of Knowledge and the Colonial Difference.” The South Atlantic Quarterly 101.1 (Winter 2002): 57–96.
    • National Center for Biotechnology Information (NCBI). “NCBI Reference Sequence: NG_005905.1 (Homo sapiens breast cancer 1, early onset (BRCA1) on chromosome 17).” Web. 1 July 2009. http://www.ncbi.nlm.nih.gov/nuccore/126015854?from=10479&to=91667&report=fasta
    • Quijano, Aníbal Quijano. “The Coloniality of Power, Eurocentrism, and Latin America.” Trans. Michael Ennis. Nepantla: Views from the South 1.3 (2000): 533–80.
    • Rama, Angel. The Lettered City. Trans. John Charles Chasteen. Durham, NC: Duke University Press, 1996.
    • Read, Justin. “Obverse Colonization: São Paulo, Global Urbanization, and the Poetics of the Latin American City.” Journal of Latin American Cultural Studies. 15.3 (December 2006): 281–300.
    • ---. “Speculations on Unicity: Rearticulations of Urban Space and Theory during Global Crisis.” CR: The New Centennial Review 9.2. In press.

    Notes

    1. There is no room for some a priori or ultimate Cause or Reason in the Unicity, not even as a negative recess. return to text
    2. This is the general argument advanced by the Uruguayan critic Angel Rama, in one of the most important works of Latin American cultural theory, La ciudad letrada. return to text
    3. Cf. Aníbal Quijano. Quijano and his interlocutors see “coloniality” (not just colonialism) as the dominant epistemological paradigm of global power (capitalism) since the European conquest of the Americas. Any attempt to critique epistemology and power without recognizing a connection to coloniality is doomed only to reiterate the dominance of coloniality. Thus, interlocutors such as Walter Mignolo seek to operate from the “exteriority” of coloniality—the borderline, the margin—since speaking from a position of “interiority” would only be self-destructive and ineffectual. My theory of Unicity concurs with this world-view in certain respects, but diverges robustly in others. The reason it is ineffectual to speak from “interiority” is that there is no such thing as an interior. The Unicity only exists in absolute exteriority—primarily because the historical roots of the Unicity are to be found in the lines of political-economic and techonological dependency between global wealth and global poverty. Global wealth and global poverty, in other words, are not different but rather produced simultaneously as co-dependent differential relations. In spatial terms, wealth and poverty occupy, respectively, the exones and intrones that compose the Unicity (terms which will be defined later in this essay). Thus, Mignolo and Quijano do speak from the exteriority of the coloniality of power, but only to the extent that the Unicity represents the “obverse” re-colonization of the planet as absolute exteriority. They speak from the exteriority because exteriority is all there is. Their critical work will only prove moderately successful at best, because both operate from an exone, even though they purport to speak for the introne. return to text
    4. As a clarification, we may follow Lefebvre and think of the Unicity as “the urban” rather as “a city.” Writing in 1970 Lefebvre states: “I’ll begin with the following hypothesis: Society has become completely urbanized. This hypothesis implies a definition: An urban society is a society that results from a process of complete urbanization. This urbanization is virtual today, but will becomre real in the future” (Lefebvre, Urban Revolution 1). And later in the same work: “From this point on I will no longer refer to the city but to the urban” (45). return to text
    5. For this reason it is not possible to “include” those who habit the introne by giving them computers or credit cards or microcredit, since they were never “excluded” in the first place. return to text